CARDIOVASCULAR JOURNAL OF AFRICA • Volume 34, No 2, May/June 2023 AFRICA 101 To validate the candidate circRNA, qPCR was conducted in an independent cohort (control group, n = 12; type II cardiorenal syndrome group, n = 15). The sequences of the primers used in the qPCR assay are shown in Table 4. The expression level of hsa_cir_0001763 was higher than in the control group and the differences are significant (p < 0.05) (Fig. 3). ROC curve analysis was performed on hsa_cir_0001763 and the results are shown in Fig. 4. The area under the curve of hsa_cir_0001763 was 0.9333, the sensitivity was 86.67% and the specificity was 83.33%. The correct rate of hsa_cir_0001763 in predicting type II cardio-renal syndrome was 85.18%, indicating that the higher the level of hsa_cir_0001763, the more likely it is type II cardio-renal syndrome. Discussion A large dataset of 118 465 individual hospitalisations in the ADHERE study showed that 27.4, 43.5 and 13.1% of patients were found to have mild, moderate and severe kidney dysfunction, respectively, at hospital admission.19 MiR-33a/b has become the therapeutic target of AS therapy. Inhibiting the expression of miR-33a/b can regulate the highdensity lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) concentrations in plasma, thereby reducing the risk of cardiovascular disease.20 By acting on lysophosphatidic acid 1 (LPA1), miR-23a can be involved in LPA-induced cardiac hypertrophy.21 By influencing Ca2+-ATPase isoform 2a (SERCA2a), miR-328 affects the intracellular calcium Table 4. Nucleotide sequences of primers used for qPCR Gene GB accession Primer sequence 5′-3′ Ampli- cation GAPDH NM_ 002046 F TGTTGCCATCAATGACCCCTT 202 R CTCCACGACGTACTCAGCG hsa_circ_0001763 F GGGCCTTTTACCCCTTCTCA 83 R CACAAAAGCAGCATCCCAGG 1.5 1.0 0.5 0.0 hsa_circ_0001763 Fig. 3. Expression levels of hsa_cie_0001763 quantified by qPCR; p < 0.05. Sensitivity 0.0 0.2 0.4 0.6 0.8 1.0 1 – Specificity 1.0 0.8 0.6 0.4 0.2 0.0 AUC = 0.9333 Fig. 4. ROC curve of hsa_cir_0001763 predicting type II cardio-renal syndrome. Table 3. Differentially expressed circRNAs between controls and type II cardio-renal syndrome patients Upregulated circRNAs p-value Fold change hsa_circ_0001763 0.0000226472 9.681799148 hsa_circ_0001759 0.0000442128 8.565984074 hsa-circRNA5782-4 0.0002778234 6.329934364 hsa_circ_0001764 0.0001070090 6.215848884 hsa_circ_0132947 0.0000033693 5.969863323 hsa_circ_0051325 0.0000092520 5.553190277 hsa_circ_0139876 0.0000028640 5.271683341 hsa-circRNA7389-1 0.0004643310 5.164052814 hsa-circRNA6035-8 0.0000077251 4.989546362 hsa_circ_0001883 0.0008435011 4.891153108 hsa_circ_0071541 0.0000101539 4.74568679 hsa_circ_0082795 0.0001705474 4.708495187 hsa_circ_0081876 0.0000140628 4.684727736 hsa_circ_0083681 0.0000747250 4.65072951 hsa_circ_0071542 0.0000095920 4.619419478 hsa_circ_0071540 0.0000205245 4.561207846 hsa_circ_0029410 0.0000005720 4.49370764 hsa_circ_0011480 0.0000746052 4.47104304 hsa_circ_0125930 0.0000466718 4.406094515 hsa_circ_0139875 0.0000353660 4.405606482 Downregulated circRNAs p-value Fold change (abs) hsa_circ_0053004 0.0181757908 4.841337494 hsa_circ_0092238 0.0496721135 4.834736027 hsa-circRNA9066 0.0030025669 4.553647025 hsa-circRNA15276-14 0.0058105186 4.544742884 hsa_circ_0009019 0.0485493228 4.213771505 hsa_circ_0079598 0.0002056310 2.626330658 hsa-circRNA4561 0.0045634624 3.724823706 hsa_circ_0140727 0.0493924498 3.723693514 hsa_circ_0122753 0.0010843791 3.710459049 hsa_circ_0140733 0.0428187571 3.646571189 hsa_circ_0055862 0.0031498204 3.645487752 hsa_circ_0093064 0.0170610147 3.643253456 hsa_circ_0092239 0.0338184217 3.632085446 hsa-circRNA6814-2 0.0116539712 3.463494167 hsa_circ_0108421 0.0258561292 3.449003465 hsa_circ_0098590 0.0058508762 3.369784458 hsa_circ_0092236 0.0251626330 3.366304545 hsa-circRNA9120-1 0.0110546520 3.364263543
RkJQdWJsaXNoZXIy NDIzNzc=