CARDIOVASCULAR JOURNAL OF AFRICA • Volume 31, No 1, January/February 2020
AFRICA
27
the manufacturer) were quickly filled and the catheter tip was
submerged in warm, fresh heparinised blood. The conductance
changes in the volume channel were recorded and the volume
was then calculated.
The heart rate (HR), end-systolic pressure (Pes), end-diastolic
pressure (Ped), end-systolic volume (Ves), end-diastolic volume
(Ved), stroke volume (SV), ejection fraction (EF), peak rate of
the increase in pressure (dP/dt
max
), peak rate of the decrease in
pressure (–dP/dt
min
), slope of the end-systolic pressure volume
relationship (ESPVR), relaxation time constant (Tau), and slope
of the end-diastolic pressure–volume relationship (EDPVR)
were detected. The pressure–volume loop (PV loop) was drawn,
with pressure on the
y
-axis and volume on the
x
-axis.
Electrocardiography
Adaptive electrocardiography (ECG) training was performed
in all experimental rats. ECGs were recorded from rats in the
control group in a quiet state for five minutes after 14 days of
intraperitoneal injections of normal saline. In the EE, SLE and
SHE groups, ECGs were recorded for five minutes immediately
after exhaustive swimming. Wide-awake rats were placed in
the rat cage, and both sets of limbs and the right forearm were
routinely disinfected. Subcutaneous punctures in the extremities
were created to insert the electrodes (the left hind leg was used as
the positive electrode, the right foreleg as the negative electrode,
and the left foreleg as the grounding electrode), and the electrode
needle was fixed.
The dynamic ECG results were recorded using a PowerLab
data acquisition and analysis system. The HR, PR interval, QRS
interval, QT interval, P amplitude, R amplitude, ST height and T
amplitude were obtained.
Enzyme-linked immunoassays for ROS, CAT and
GSH levels in the myocardium
The heart was removed from the –80°C freezer and left ventricular
myocardial tissue was sheared, weighed and diluted to produce a
10% homogenate in phosphate-buffered saline (PBS) (0.01 mol/l,
pH 7.2). All procedures were performed on ice. The mixture was
centrifuged at 5 000 rpm for 10 minutes at a low temperature,
drained and placed in a new EP tube for storage.
Enzyme-linked immunosorbent assays were performed
according to the instructions included in the kits. The optical
density (OD) of each sample was measured at 450 nm. The OD
value for the standard was measured, and a standard curve was
constructed with the OD value on the
y
-axis and concentration
on the
x
-axis. The concentration of the indicated marker in each
sample was obtained from the standard curve.
q-PCR of mRNA levels in rat myocardial tissues
All gene sequences were obtained from GenBank (http://
www.ncbi.nlm.nih.gov) and primers were synthetised by
Invitrogen, Beijing. The upstream primer for Keap1 was
GTGGAGACAGAGACCTGGACTTTC, its downstream
primer was TGTCAAGCGGGTCACTTCACTC, and the
product size was 178 bp. The upstream primer for Nrf2 was
AAGATGCCTTGTACTTTGAAGACTGT, its downstream
primer was GGAAAATAGCTCCTGCCAAACTT, and the
product size was 223 bp. The upstream primer for actin was
CCTAAGGCCAACCGTGAAAA, its downstream primer was
GACCAGAGGCATACAGGGACA, and the product size was
106 bp.
The TRIzol total RNA extraction reagent was used to
extract RNA from the samples, and real-time polymerase chain
reaction (PCR) was performed according to the instructions for
cDNA reverse transcription and PCR. In the reaction system,
the fluorescent dye SYBR Green I was added for real-time
monitoring, and the relative expression level of the target gene
was analysed using the 2
-
ΔΔ
CT
method. The reaction system was:
2X mix, 10
μ
l; upstream primer (10
μ
M), 0.5
μ
l; downstream
primer (10
μ
M), 0.5
μ
l; template 2, 10
μ
l; and sterilised distilled
water to a 20-
μ
l total volume. The following amplification
procedure was used: 95°C for 30 seconds, followed by 45 cycles
of 95°C for five seconds and 60°C for 40 seconds.
Western blot analysis of Keap1 and total and nuclear
Nrf2 levels in the left ventricular myocardium
The heart was removed from a –80°C freezer, left ventricular
myocardial tissue was sheared on ice, minced with fine scissors,
and 50 mg was removed and mixed with lysis buffer containing
protease inhibitors and a phosphatase inhibitor. The solution
was intermittently homogenised with an electric homogenate
machine for one minute, incubated on ice for 30 minutes, and
centrifuged at 12 000 rpm for 20 minutes at 4°C. The supernatant
was then placed in a 0.5-ml centrifuge tube.
The nucleoproteins were extracted according to the
manufacturer’s instructions. Protein concentrations were
determined using the bicinchoninic acid (BCA) method with
bovine serum albumin as the standard. Then the protein samples
were diluted to the same volume and heated at 100°C for five
minutes after the addition of an equal volume of loading buffer.
The denatured protein samples were separated by sodiumdodecyl
sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) at 100 V
for two hours and transferred to polyvinylidene fluoride (PVDF)
membranes. The membranes were blocked with blocking buffer
containing 5% skim milk at room temperature for one hour and
then incubated with primary antibodies overnight at 4°C.
After the membranes were washed three times with Tris-
buffered saline (TBS) containing Tween, they were incubated
with secondary goat anti-mouse IgG antibodies conjugated to
horseradish peroxidase for one hour at room temperature, and
then exposed to ECL for one to two minutes to detect the bands.
A gel imaging system was used to capture images and for the
quantitative analysis, and grayscale values were determined.
Statistical analysis
The data are presented as means
±
SD. SPSS 17.0 statistical
software was used to analyse all experimental data. A single-
factor analysis of variance was used for comparisons of multiple
means after a one-way ANOVA and homogeneity test were first
performed. Comparisons of mean values between two groups
were performed using the LSD test if the variance was equal or
Dunnett’s T3 method if the variance was unequal. A correlation
analysis was performed by calculating Pearson’s correlation
coefficients. A single-factor regression analysis was performed;
p
<
0.05 was considered to indicate a significant difference.




